3). Taken together, σM seems to play a central role in rhamnolipid resistance, while σW and the LiaRS TCS have only minor functions. Here, we present the first

investigation of the transcriptional response to rhamnolipids, industrially important surface-active molecules with antimicrobial properties. Ceritinib molecular weight In B. subtilis, exposure to rhamnolipids provokes a complex reaction that combines the cell envelope and secretion stress response (Fig. 2d). The main regulators orchestrating this response are the TCS LiaRS and CssRS, as well as the ECF σ factor σM. In addition to the target genes of these regulators, a number of genes encoding either metabolic enzymes or hypothetical proteins of unknown functions are also induced. Our data show a protective role of LiaRS and σM against rhamnolipid damage, while the CssRS TCS has no effect on

rhamnolipid sensitivity (Fig. 3). As rhamnolipids alter the properties of membranes, induction of the cell envelope stress response could help to maintain cell envelope integrity. While the physiological role of most of the strongly induced genes has not been elucidated yet, some of them have known or assumed functions in counteracting membrane damage. The LiaR-controlled liaIH operon encodes a small membrane protein and a member of the phage-shock protein family, respectively. Their gene products have recently been linked to resistance against daptomycin, another membrane-perturbating agent (Hachmann et al., 2009; Wolf et al., 2010). Other genes, like the clonidine GSK 3 inhibitor ECF-regulated bcrC gene and the pbpE-racX operon encode functions involved in cell envelope biogenesis, which might

also help to stabilize the envelope against membrane damage. Moreover, and given the prominent role of σM in protecting cells from rhamnolipid damage (Fig. 3), it is noteworthy that some of the most strongly induced σM-target genes of unknown function, such as yebC, ywnJ or ydaH, encode putative membrane proteins (Table 3). A possible role of these proteins in counteracting membrane damage needs to be addressed in future studies. In contrast, the physiological role of CssRS activation by rhamnolipids is not clear. Its induction could indicate severe changes of membrane protein composition and accumulation of misfolded secreted proteins in the cell envelope caused by rhamnolipid treatment. Alternatively, rhamnolipid-dependent interference with membrane integrity could affect functionality of the secretion machinery. The CssRS TCS has also been shown to be not only induced by mammalian peptidoglycan recognition proteins, but also seems to be required for the killing mechanism of these proteins (Kashyap et al., 2011). Although the data presented here clearly indicates that rhamnolipids interfere with cell envelope integrity, future studies will be required to gain an understanding of the mode of action of rhamnolipids and its use as antimicrobial active compound.

By definition, extracellular enzymes are proteins completely dissociated from the cell and found free in the surrounding medium or within

the exopolymeric matrix (Priest, 1977). At least 200 proteins compose the B. subtilis‘secretome,’ which also includes the proteins responsible for the secretion of extracellular enzymes (Tjalsma et al., 2000; Antelmann et al., 2001). Three distinct pathways for protein export from the cytoplasm to the surrounding environment have been identified in INCB024360 chemical structure B. subtilis. Most protein export follows the Sec-SRP pathway that secretes proteins directly into the growth medium. A smaller number of proteins are secreted via twin-arginine translocation pathway or ABC transporters in B. subtilis (Ling Lin et al., 2007). Some extracellular enzymatic activities have been demonstrated while others have not due to the difficult task of distinguishing free enzymes find more from those associated to the cell wall. According to Tjalsma et al. (2004), the secretome also includes peptides with antibiotic functions. Bacillus subtilis produce a wide variety of antibiotics, with peptide antibiotics representing the dominant class. These peptide antibiotics exhibit a rigid structure, are resistant

to hydrolysis by peptidases and proteases and can have amphipathic (discussed in Surface-active EPS) or nonamphipathic properties. Peptide antibiotics are reviewed by Stein (2005), and a description of the secretome has been summarized (e.g. Priest, 1977; Simonen & Palva, 1993; Antelmann et al., 2001). Both subjects are beyond the scope of this review, which focuses on extracellular proteins involved in the architecture and chemical modification of the exopolymeric matrix. In this initial category enzymes involved in the chemical modification of polysaccharides are discussed, with two main examples. The first is levansucrase (2,6-β-d-fructan-6-β-d-fructosyl-transferase) encoded by sacB and involved in the synthesis of levan. Levansucrase is an exoenzyme, whose synthesis is highly inducible by sucrose. When sucrose is used as a

substrate, levansucrase Ergoloid transfers the fructose residue to the acceptor levan (Shida et al., 2002; Castillo & Lopez-Munguia, 2004). Levansucrase is secreted by the SecA pathway and increased levels of SecA result in an elevated production of exogenous levansucrase (Leloup et al., 1999), indicating a strict control for its regulation. The second enzyme active on polysaccharides is levanase (β-d-fructofuranosidase) encoded by sacC and responsible for levan degradation (Gay et al., 1983; Wanker et al., 1995). SacC acts in single-chain mode, is active on levan, inulin and sucrose (Wanker et al., 1995; Shida et al., 2002) and is induced by low concentrations of fructose (Martin et al., 1989). Inactivation of SacC results in an increase in levan polymerization possibly due to the loss of the degradative activity of the SacC protein (Shida et al., 2002).

, 2000). The purified degenerate probe (TIB Molbiol, Berlin, Germany) was digoxygenin labelled at both the 5′ and the 3′ ends. Colony hybridization was conducted as described in the digoxygenin application manual for filter hybridization (Roche, Mannheim, Germany). Hybridization was conducted with 10 mL DIG Easy Hyb solution containing 25 ng mL−1 digoxygenin-labelled probe for 4 h at 30 °C. Antidigoxygenin conjugated with alkaline phosphatase (Anti-Digoxygenin-AP, Fab fragments, Roche) and digoxygenin detection buffer (Roche) was used for probe–target hybrid detection. The detection buffer contained 0.175 mg mL−1 5-bromo-4-chloro-3-indolyl phosphate, toluidine salt and 0.349 mg mL−1

Epigenetics Compound Library nitro blue tetrazolium chloride. The rest of the procedure was conducted according to the AZD1208 order digoxygenin application manual. Positive clones were subjected to plasmid extraction and purification. Sequencing was performed at Inqaba Biotechnical Industries (South Africa) using a Spectrumedix SCE2410 genetic analysis system (SpectruMedix, State College, PA). Homology searches were performed against the nonredundant nucleotide GenBank database using the basic local alignment search tool (blast (Altschul et al., 1990). An ORF encoding a putative thioredoxin reductase (other than the soluble ferric reductase) was found in

the draft genome sequence of T. scotoductus SA-01, which became available later (conducted by our group, unpublished data). The soluble ferric reductase (FeS, accession number FN397678) was amplified using a forward primer (CAT ATGGAGCACACCGACGTGATCATC) with an NdeI recognition site (underlined) and a reverse primer (GAATTC AGGCCGGTGCTTTCTCCTC) with an EcoRI recognition site (underlined). The thioredoxin Quinapyramine reductase (TrxB, accession number FN397677) was also amplified by PCR using a forward primer (CATATGGAGTTCACCCTCACGGGGC TTG) and a reverse primer

(GAATTCTAGGGTTTTACC TTCTCGTGGGCCTC) with NdeI and EcoRI recognition sites, respectively. The PCR products of the above-mentioned ORFs were ligated into pGEM®-T easy (Promega, Madison, MI) according to the manufacturer’s instructions and transformed into One Shot TOP10 (Invitrogen, Carlsbad, CA) chemically competent E. coli cells for proliferation. The plasmids were isolated using the Biospin Gel extraction kit (Bioflux, China), double digested with EcoRI (0.5 U μL−1, Fermentas) and NdeI (0.5 U μL−1, Fermentas) for 4 h at 37 °C and subcloned into the pET28b(+) vector. These recombinant clones were verified by sequencing and transformed into BL21(DE3) (Lucigen) chemically competent cells according to the manufacturer’s instructions. The transformants were inoculated into kanamycin-containing (50 mg mL−1) Luria– Bertani media and cultured until an OD600 nm of 0.8 was reached before isopropyl-β-d-thiogalactopyranoside was added to a final concentration of 1 mM to induce expression.

PCT guidelines are primarily in line with the BNF but do not recommend a specific dose. http://www.selleckchem.com/products/Adriamycin.html Formularies should include dose information as incorrect dosing of antibacterial agents, specifically under-dosing, is likely to lead to the development of resistance. The ability to adhere to course duration recommendations may be linked to the availability of standard pack sizes as conditions where 7 days treatment is recommended also have 7 day patient packs available. If primary care is going to improve its antibiotic stewardship it may be necessary for prescribers to work with other

healthcare professionals to help ensure adherence to best practice guidance. Since pharmacists are the final check before the medication goes to the patient they have the potential to intervene if systems can be set up to make them aware of the prescribed indication. Further work is needed to develop local Y-27632 molecular weight protocols to facilitate collaboration with prescribers and GPs on antibiotic prescribing. 1. Health Protection Agency. Management of Infection Guidance for Primary Care for Consultation and Local Adaption. July 2010. 2. NHS Norfolk. Treatment of Infections in Primary Care and Community Hospitals. April 2011. Heena Dhabali, Simon White, Nazmeen Khideja Keele University, Staffordshire,

UK This study aimed to explore the extent of shisha pipe smoking among undergraduate pharmacy students from a UK school of pharmacy and their awareness of the associated health risks. The findings suggest that 40% of participants had previously smoked a shisha pipe but not on a regular basis (i.e. less than monthly), which is similar to the findings of previous studies among UK university students. The vast majority of participants who knew what shisha smoking entailed (90%) indicated that they were aware of the health risks of shisha smoking. Narghile, hubble-bubble and hookah are among the many names used for what is perhaps most commonly known as a shisha or water-pipe, through which substances (usually tobacco and often combined with other substances such as fruit molasses) are smoked. Long popular in Middle Eastern and Asian cultures, it is becoming increasingly popular in

the UK, especially among young people.1 Previous studies have found between approximately 27% and 40% of Resveratrol university student participants have tried shisha smoking, with around 20% smoking shishas regularly (at least monthly).1,2 Studies have also suggested a lower awareness among students of the health risks of shisha smoking compared to the risks of cigarette smoking.1 However, studies have not explored the extent of usage among pharmacy students or their awareness of the health risks of shisha smoking. As such, this study aimed to explore these topics among undergraduate pharmacy students from one school of pharmacy. Following ethical approval, all undergraduate pharmacy students in the school were verbally invited to participate in a paper-based questionnaire survey.

In conclusion, DSNs provide hundreds of hours of telephone advice annually that improve ongoing diabetes care and represent a cost-effective method of reducing the number of acute hospital admissions. Copyright © 2012 John Wiley & Sons. “
“This paper examines and summarizes data on knee osteoarthritis (AO) in Community Oriented Program For Control Of Rheumatic Disorders (COPCORD) publications. A literature search Raf inhibitor was made through PubMed, Google, Proceedings of Asia-Pacific League of Associations for Rheumatology (APLAR) congresses, and Abstracts from APLAR congresses. Data

were compiled to examine the prevalence of knee OA and knee pain, sex ratio, urban/rural differences and other risk factors. Data on knee pain and OA were available in a total of 36 COPCORD publications. The pooled prevalence of knee OA was 7.9% in adults above the age of 15 years. It was more common in women. Overweight, squatting and cycling

appeared to be modifiable risk factors for knee OA. OA of the knee is the commonest rheumatic disease in studied communities. Further research is needed for identification of its modifiable risk factors and development of strategies for reduction of the community burden of this malady. “
“Worldwide, osteoarthritis (OA) is estimated to be the fourth MAPK Inhibitor Library datasheet leading cause of disability. Most of this disability burden is attributable to the involvement of the hips or the knees. OA is strongly associated with ageing and the Asian region

is ageing rapidly. Further, OA has been associated with heavy physical occupational activity, a required livelihood for many people living in rural communities in developing countries. Unfortunately, joint replacement surgery, an effective intervention for people with severe OA involving the hips selleck chemicals or knees, is inaccessible to most people in these regions. On the other hand, obesity, another major risk factor, may be less prevalent, although it is on the increase. Determining region-specific OA prevalence and risk factor profiles will provide important information for planning future cost-effective preventive strategies and health care services. An update of what is currently known about the prevalence of hip and knee OA from population-based studies conducted in the Asian region is presented in this review. Many of the recent studies have conducted comparisons between urban and rural areas and poor and affluent communities. The results of Asian-based studies evaluating risk factors from population-based cohorts or case–control studies, and the current evidence on OA morbidity burden in Asia is also outlined. “
“Introduction:  Behcet’s Disease (BD) is classified as a vasculitis, and progresses via attacks and remissions.

He is working for a large oil corporation and will be traveling to Nigeria for a 4-day meeting. He does not feel he needs advice on returning to his home country but his company has sent him for a pre-travel evaluation. Case 5 Two 18-year-old college students, including a Canadian native who is traveling with roommate to visit a Colombian friend for a 5-week stay with the friend’s family on a ranch outside of Bogota, Colombia. She is not planning to seek health advice because she says, “She had just enough to buy her ticket and it is a waste of money anyway. Case 6 A 57-year-old Chinese businessman with a history of type II diabetes who is going to Dar es Salaam, Tanzania for 6 weeks to visit his

son who immigrated to Tanzania and runs a car rental agency. He is Dasatinib ic50 planning a 3-day trip to a remote area for a field visit where he will also be looking for natural resources investments. Case 7 A 42-year-old Hmong male from Minnesota is bringing his 16-year-old son to Thailand selleck compound for 2 weeks. They will be staying in Chang Mai at a high-end hotel. They will visit the camps on the Burma border for 1 day so that the father can show his son where his parents came from. They will also do a river-rafting trip. They have come to seek pre-travel care because the father is worried about

both of their health risks. These scenarios illustrate the application of a new definition of VFR traveler. Within these scenarios some factors will change over time but the two required

criteria for inclusion as a VFR traveler are stable and robust: VFR and an epidemiological gradient of risk based on assessment of the determinants of health. These stable criteria can lead to evaluation of its definitional validity in assessing travel-related health risks and potentially differentiating VFR travelers from other travelers for the purpose of clinical assessment, public health planning, and the development of research. The consistent application of these defining criteria for VFR travel is to allow a means of identifying a combination of variables contributing nearly to the VFR travelers’ experience of travel-related disease or injury compared with other groups of travelers. This information can be used to identify and plan for the mitigation of adverse outcomes. Further, this definition will contribute to the design and implementation of public health policies and programs, and a coherent approach to VFR traveler research, data collection, analysis, and communication. The increased morbidity and mortality for certain outcomes reported in the VFR travelers literature is likely related to measurable differences in the intent of travel, and health determinants with interregional disparities in disease risk. A better understanding of the interaction of the determinants of health across regions of health disparity may lead to improved interventions to reduce adverse health outcomes related to VFR and other potentially high-risk traveling populations.

PCR was performed using Biomix (Bioline, London, UK) polymerase or HotStar HiFidelity polymerase kit (Qiagen, Crawley, UK) according to the manufacturer’s instructions with the addition of 5% DMSO. Generation of a GlnR deletion mutant and the GlnR D48A point mutation strain were performed using the recombineering method (van Kessel & Hatfull, 2007, 2008a, b). For generation of the GlnR deletion mutant, upstream and downstream sequences flanking glnR (msmeg_5784) were amplified from M. smegmatis genomic DNA by PCR as stated; primer sequences are listed in Table 2. The flanking regions were designed so as not to disrupt any neighbouring

EX-527 genes or introduce any downstream effects. Vector pYUB854 was used to subclone the homologous flanking sequences either side of

a hygromycin resistance (HygR) cassette (Bardarov et al., 2002). Allelic exchange sequence (AES) DNA was prepared by digesting the pYUB854_glnR construct with AflII and SpeI. Linear AES DNA (200 ng) was used to transform M. smegmatis cells containing the pJV126 recombineering plasmid (a gift from Graham Hatfull). Putative null mutants were selected on 7H11 Staurosporine research buy agar containing hygromycin (50 μg mL−1) and kanamycin (50 μg mL−1). The GlnR_D48A point mutation was generated using M. smegmatis containing the pJV128 recombineering plasmid (a gift from Graham Hatfull). Cells were cotransformed with 100 ng of two ssDNA oligonucleotides: GlnR_Point_mut containing the base pair changes for the required glnR D48A point mutation and HygS_Repair containing the required base pair changes to convert the hygromycin resistance cassette from nonfunctional to functional (Table 2). until This hygromycin resistance repair method was used to select colonies that had undergone recombination. A mismatch amplification

mutation assay (MAMA) PCR screen using primer pairs MAMA_PCR_F and MAMA_PCR_R was performed to identify glnR containing the desired point mutation (Cha et al., 1992; Swaminathan et al., 2001). MAMA PCR conditions were: 95 °C for 5 min, 39 cycles of 95 °C for 15 s, 32 °C for 1 min, with final extension time of 72 °C for 7 min. Recombineering plasmids were removed from both mutant strains via negative sacB selection (Pelicic et al., 1996). Confirmation of a GlnR D48A point mutation was carried out by amplifying the entire glnR genomic region using primer pairs GlnR_reg_F and GlnR_reg_R with high fidelity polymerase, and sequencing the glnR gene with GlnR_D48A_SeqF and GlnR_D48A_SeqR (Table 2). Confirmation of GlnR deletion was carried out by PCR using primers outside the upstream and downstream flanking regions in combination with hygromycin cassette–specific primers (Table 2). PCR products would only be obtained with insertion of the hygromycin cassette by recombination onto the chromosome at the correct location. Further confirmation of GlnR deletion phenotype was provided by Western analysis using a custom-made GlnR polyclonal antibody (Eurogentec, Seraing, Belgium).

PCR was performed using Biomix (Bioline, London, UK) polymerase or HotStar HiFidelity polymerase kit (Qiagen, Crawley, UK) according to the manufacturer’s instructions with the addition of 5% DMSO. Generation of a GlnR deletion mutant and the GlnR D48A point mutation strain were performed using the recombineering method (van Kessel & Hatfull, 2007, 2008a, b). For generation of the GlnR deletion mutant, upstream and downstream sequences flanking glnR (msmeg_5784) were amplified from M. smegmatis genomic DNA by PCR as stated; primer sequences are listed in Table 2. The flanking regions were designed so as not to disrupt any neighbouring

Obeticholic Acid genes or introduce any downstream effects. Vector pYUB854 was used to subclone the homologous flanking sequences either side of

a hygromycin resistance (HygR) cassette (Bardarov et al., 2002). Allelic exchange sequence (AES) DNA was prepared by digesting the pYUB854_glnR construct with AflII and SpeI. Linear AES DNA (200 ng) was used to transform M. smegmatis cells containing the pJV126 recombineering plasmid (a gift from Graham Hatfull). Putative null mutants were selected on 7H11 www.selleckchem.com/products/dinaciclib-sch727965.html agar containing hygromycin (50 μg mL−1) and kanamycin (50 μg mL−1). The GlnR_D48A point mutation was generated using M. smegmatis containing the pJV128 recombineering plasmid (a gift from Graham Hatfull). Cells were cotransformed with 100 ng of two ssDNA oligonucleotides: GlnR_Point_mut containing the base pair changes for the required glnR D48A point mutation and HygS_Repair containing the required base pair changes to convert the hygromycin resistance cassette from nonfunctional to functional (Table 2). Cobimetinib datasheet This hygromycin resistance repair method was used to select colonies that had undergone recombination. A mismatch amplification

mutation assay (MAMA) PCR screen using primer pairs MAMA_PCR_F and MAMA_PCR_R was performed to identify glnR containing the desired point mutation (Cha et al., 1992; Swaminathan et al., 2001). MAMA PCR conditions were: 95 °C for 5 min, 39 cycles of 95 °C for 15 s, 32 °C for 1 min, with final extension time of 72 °C for 7 min. Recombineering plasmids were removed from both mutant strains via negative sacB selection (Pelicic et al., 1996). Confirmation of a GlnR D48A point mutation was carried out by amplifying the entire glnR genomic region using primer pairs GlnR_reg_F and GlnR_reg_R with high fidelity polymerase, and sequencing the glnR gene with GlnR_D48A_SeqF and GlnR_D48A_SeqR (Table 2). Confirmation of GlnR deletion was carried out by PCR using primers outside the upstream and downstream flanking regions in combination with hygromycin cassette–specific primers (Table 2). PCR products would only be obtained with insertion of the hygromycin cassette by recombination onto the chromosome at the correct location. Further confirmation of GlnR deletion phenotype was provided by Western analysis using a custom-made GlnR polyclonal antibody (Eurogentec, Seraing, Belgium).

The increased ACP-196 concentration expression of these motility-related genes correlates with increased flagellation observed in the swarmer cells. Increased resistance to multiple antibiotics has been associated with swarmer cells of Salmonella (Kim & Surette, 2003; Kim et al., 2003), Pseudomonas aeruginosa, Escherichia coli, Bacillus subtilis, Serratia marcescens, and Bacillus thailandensis (Lai

et al., 2009). To determine whether swarmer cells of R. leguminosarum also exhibit increased antibiotic resistance, we compared the antibiotic resistance profile of VF39SM vegetative cells with swarmer cells using antibiotics with different mechanisms of action. These antibiotics included nalidixic acid (inhibits DNA replication), rifampicin (inhibits transcription), chloramphenicol (inhibits protein translation), and cephalexin (inhibits cell-wall synthesis). Whereas VF39SM vegetative cells were susceptible to all antibiotics tested, to varying degrees, the VF39SM swarmer cells were resistant to these antibiotics (Fig. 5).

Similarly, we also observed susceptibility of 3841 vegetative cells and increased resistance of 3841 swarmer cells to the same set of antibiotics (Fig. 5). To establish that the resistance of the swarmer cells to the antibiotics tested was due to an adaptation associated with swarming, dedifferentiated swarmer cells were reassayed for antibiotic resistance using the same set of antibiotics. Swarmer cells were streaked on TY agar and then used to inoculate TY broth. The broth cultures were used to inoculate swimming and solid plates (containing swarm medium) and Cytoskeletal Signaling inhibitor an antibiotic resistance assay was performed as described above. The dedifferentiated cells were

susceptible to all the antibiotics tested (data Sulfite dehydrogenase not shown). The results of this study demonstrate that R. leguminosarum is capable of swarming motility. Swarming depends on the interplay of several features, including agar concentration, incubation temperature, cell density, and nutrient-rich medium. Bacterial swarming is typically observed on a solidified medium containing 0.5–2% agar (Verstraeten et al., 2008). In R. leguminosarum, surface migration was supported by agar concentrations ranging from 0.5% to 1%. Swarming was observed at 22 °C, but not at the normal laboratory incubation temperature of 30 °C. Stimulation of swarming at a low temperature has been demonstrated previously in Pseudomonas putida KT2440 (Matilla et al., 2007) and S. marcescens (Lai et al., 2005). Pseudomonas putida KT2440 swarmed from 18 to 28 °C, but not at 30 °C (Matilla et al., 2007). Serratia marcescens, on the other hand, swarms at 30 °C, but not at 37 °C. Because, in nature, changes in temperature normally indicate changes in humidity, the low incubation temperature probably serves as an indicator of the softness of the swarm medium for the bacterial cells, thereby stimulating swarming motility (Matilla et al., 2007).

, 2011). For information on the commercial value and application of cold-active enzymes, Dabrafenib clinical trial we suggest reading Marx et al. (2007). One of the major adaptations of cold-proteins includes modifications of structural features that increase flexibility, and specific amino acids have emerged as key elements (Marx et al., 2007). Glycine has been reported as an important residue to improve the flexibility of protein structure, providing more amplitude to the relative movements between elements of the secondary structure. In pioneering work, Saunders et al. (2003) compared the global proteomes of two cold-adapted Archaea (Methanogenium frigidum

and Methanococcoides burtonii) with mesophilic proteomes. They found that these cold-adapted prokaryotes displayed higher frequencies of charged polar residues (mainly Gln and Thr) and a lower frequency of hydrophobic amino acids, mainly Leu. Using a different approach, Kinase Inhibitor Library datasheet Gianese et al. (2001) showed that, among psychrophilic enzymes, Ala and Asn were increased and Arg decreased at exposed sites, and some other differences

were found within α-helices and β-strands. More recently, Grzymski et al. (2006) showed that the most significant changes found in Antarctic bacterial protein sequences were a reduction of Pro, stabilizing hydrophobic clusters, and in salt-bridge-forming residues (Arg, Glu, and Asp). The availability of more genome sequences from psychrophilic microorganisms will be crucial

for understanding the adaptation of proteins to a cold environment, which in turn will have an obvious biotechnological application. Relevant biotechnological cold-active bacterial enzymes have been identified using culture-dependent studies (Margesin & Schinner, 1994; Vazquez et al., 2004; Martínez-Rosales & Castro-Sowinski, 2011; among many others). Currently, however, the most promising approach is based upon metagenomics, a culture-independent genomic MYO10 analysis. Functional metagenomics relies on the extraction of environmental DNA and subsequent cloning to eventually identify the entire genetic set of a habitat. This allows the analysis of a wide diversity of genes and their products as well as the study of their potential for biotechnological use (Schmeisser et al., 2007). Through metagenomics, several cold-active enzymes with many potential biotechnological applications have been identified, cloned in heterologous hosts and characterized. Examples include lipases and esterases (Cieslinski et al., 2009; Heath et al., 2009; Yuhong et al., 2009; Berlemont et al., 2011; Yu et al., 2011; Hu et al., 2012), proteases (Berlemont et al., 2011; Zhang et al., 2011), cellulases (Berlemont et al., 2011), and glycosyl hydrolases (Berlemont et al., 2009, 2011).