Finally and in the same way, the expression of genes coding for I

Finally and in the same way, the expression of genes coding for IL-1β, IL-8 and TLR4 showed no difference between the three experimental groups. Figure 3 Genes expression levels in the magnum of GF, SPF and C groups. Gene expression levels of lysozyme (A), AvBD 10 (B), AvBD 11 (C), AvBD 12 (D), gallin (E), ovotransferrin (F), avidin (G), ovoinhibitor (H), cystatin (I), ovomucoid (J), IL1-β (K), IL8 (L) and TLR4 (M) in the Tamoxifen magnum as assessed by RT-qPCR showed no difference among the three experimental groups GF, SPF and C (n = 8; mean ± standard deviation, * p < 0.05). Data in A, D, G, H, I, K, L and M were analysed using one-way ANOVA followed by the Bonferroni-Dunn test; data in B, C, E, F and

J were analysed using the Kruskal-Wallis test followed by the Mann–Whitney test. Table 3 Functions, genes accession numbers and primers used for magnum and egg white proteins transcription studies Protein function Genes Primers Accession number Proteins with direct lytic action on bacteria Lysozyme F-GGGAAACTGGGTGTGTGTTGCA [GenBank:bFJ542564.1]   R-TCTTCTTCGCGCAGTTCACGCT AvBD 10 F-GCTCAGCAGACCCACTTTTC [GenBank:NM_001001609.1]   R-GTTGCTGGTACAAGGGCAAT AvBD 11 F-ACTGCATCCGTTCCAAAGTC Barasertib [GenBank:NM_001001779.1]   R-TGTGGCTTTCTGCAATTCTG AvBD 12 F-GGGGATTGTGCCGAGTGGGG [GenBank:NM_001001607.2]   R-TGCTGGAGGTGCTGCTGCTC Gallin F-CTCCAGCCTCGCTCACAC

[GenBank:FN550409.1]   R-TTGAGAGGAGGGGATGACAC Chelating proteins Ovotransferrin F-GACTTGCAGGGCAAGAACTC

[GenBank:NM_205304.1]   R-GCTGGCAGAGAAAAACTTGG Avidin F-CTGCATGGGACACAAAACAC [GenBank:NM_205320.1]   R-TTAACACTTGACCGCAGCAG Protease inhibiting proteins Cystatin F-ACAACTTGCCCCAAGTCATC [GenBank:NM_205500.2]   R-GGCAGCGATACAATCCATCT Ovoinhibitor F-TAAGGATGGCAGGACTTTGG [GenBank:NM_001030612.1]   R-GAGTTTGCCACCAGTGGTTT Ovomucoid F-TGCAGTCGTGGAAAGCAACGG [GenBank: FJ227543.1]   R-GCTGAGCTCCCCAGAGTGCGA Cytokines Interleukin 1 F-AGTGGCACTGGGCATCAAGG [GenBank:HQ329098.1]   R-TGTCGATGTCCCGCATGACG Interleukin 8 F-CTGCGGTGCCAGTGCATTAG [GenBank:HM179639.1]   R-CCATCCTTTAGAGTAGCTAT   TLR4 F- TTCAAGGTGCCACATCCAT Montelukast Sodium [GenBank:AY064697]     R- TAGGTCAGACAGAGAGGATA   TBP F-GCGTTTTGCTGCTGTTATTATGAG [GenBank:NM_205103.1]     R-TCCTTGCTGCCAGTCTGGAC Discussion The primary protection of the egg after being laid relies firstly on a physical defence (the eggshell and the eggshell membranes) and secondly on chemical defences mainly present in the egg white, but also in other compartments. IgY, IgM and IgA [11] participate with numerous major proteins [18] and newly identified minor proteins and peptides [4] in the innate defences of the egg. While IgY concentration have been shown to vary in egg yolk depending of the nature and degree of antigen exposure of hen [19], no evidence in the literature explored whether the antimicrobial peptides/proteins of the egg are modulated by the microbial environment of the hen.

Comments are closed.