While still at a relatively early stage of development, this technique even offers the possibility of determining the relative abundance (relative biomass) of species in a mixed (bulk) sample, a requirement in the assessment of many biological indices such as the Benthic Quality Index (Leonardsson et al., 2009). Such projects and many others show the speed at which new DNA based technologies are evolving and offering exciting opportunities for biodiversity monitoring

(Baird and Hajibabaei, 2012). The Moorea Biocode Project (Check, 2006) is Gefitinib concentration a textbook example of a comprehensive DNA barcoding project. It compiles voucher specimens, digital photographs, high-quality DNA extractions, and genetic sequences (minimally DNA barcodes) for almost all species (adult stage >1 mm) in marine, freshwater, and terrestrial habitats on the island of Moorea (136 km2) French Polynesia. So far, the project has amassed >42,000 specimens and >18,000 sequences from >7000 species: this is already an unparalleled database Proteases inhibitor for a tropical ecosystem. Moorea Biocode is also developing an IT

platform to support this research: a standards-based informatics infrastructure connecting scientific data, and tracking Access and Benefit Sharing (ABS) agreements, across disparate sites, research teams, labs, collections, and data repositories. As the Moorea reference database is populated, researchers are carrying out innovative projects (e.g. on marine plankton and food web dynamics) to demonstrate the applications of DNA barcoding in a system with a comprehensive reference library. Increasingly, these studies employ next generation sequencing technologies and metagenomics (e.g. in DOK2 gut content analyzes). They also connect to microbial surveys and the physical and ecological time-series data collected on Moorea’s coral reefs (e.g. by CNRS-EPHE CRIOBE since 1971 and the NSF MCR-LTER since

2004). Model ecosystems, like Moorea, are thus becoming ‘Genomic Observatories’, contributing to the emerging field of biodiversity genomics and mainstreaming genetic data into Earth Observing Systems (see GEO BON http://www.earthobservations.org/geobon.shtml). Metagenomics is, simply put, an extension of traditional genomics designed to encompass analysis of all genetic material in a community or assemblage of organisms, and is most often used to survey microbial species, the majority of which are recalcitrant to the culturing techniques that would provide enough DNA for genomic sequencing of an individual isolate. Since the mid 1990’s this technique has relied on isolation and cloning (into heterologous expression vectors) fragments of DNA from an environmental sample, followed by sequence or functional assay screening. However, since 2005 next-generation sequencing approaches (454-pyrosequencing, Illumina GAIIx/HiSeq/MiSeq, etc.

The most frequent complications include acute and chronic forms of twin-to-twin transfusion syndrome (TTTS). The placental anastomoses which occur in TTTS are responsible for blood transfusion from the potential ‘donor’ to the so called ‘recipient’. Docetaxel nmr These hemodynamic disturbances between the

blood circulation systems of both fetuses lead to the development of various irregularities. Consequently, the development of arterial hypertension occurs in the ‘recipient’ and hypotonia, hypovolemia and thrombosis are often observed in the ‘donor’. As a result of this, the growth of the ‘recipient’ is sped up and the development of the ‘donor’ is delayed. Discrepancies in fetal growth occur, resulting from a significant increase in the mass of the ‘recipient’ and from ‘donor’ growth limitations. These discrepancies in fetal growth are characterised by differences in body mass and stomach circumferences [3, 4]. The aim of this study was to evaluate the impact

of monochorionocity on the duration of pregnancy, perinatal mortality, and the developmental state of twins as determined by the Apgar score and by values of somatic features. This study included a group of 2526 twins of both sexes (including 536 monochorional and 1990 dichorional twins) born at the Clinic of Perinatology and Gynaecology of the Medical University of Poznan between 2003 and 2009. All the procedures were approved by the Local Ethics Committee of the Medical University in Baf-A1 in vivo Poznan. The material was characterised in terms of morphological development by the following six somatic features: body mass, total length, crown and rump length, shoulder width, head circumference, and chest circumference. The definitions of features and the methods of their measurement were in compliance with the measuring technique proposed by Martin [5]. The overall condition of the newborns was evaluated Urease on the basis of the Apgar score. The initial Apgar score used in our studies was determined at the first minute of life, while the final one was determined at the tenth minute of

life. Additionally, histopathological examinations involving the placenta evaluated the degree of morphological-functional disturbances. The studied material was analysed statistically by means of basic statistical characteristics. To ascertain if the studied somatic features were variable in context of the analysed factors, and to possibly determine their significance, variance analysis testing was applied for the repeated measurements. The Pearson χ2 statistics used in the analysis indicated the presence of a dependency between the frequency of premature births and deaths and the number of chorions in the placentas of twins. Calculations were performed using the Statistica 8 (StatSoft®, Poland) package, with statistical significance defined as p≤0.05.

Dies wurde für den Fall einer hohen Konzentration von LMM-Metallspezies im Serum nach übermäßiger Exposition gegenüber Mn als Risiko angesehen. Die Ergebnisse von Nischwitz et al. [57] standen im Einklang mit den Daten von Yokel [3], der gefunden hatte, dass Mn-Citrat eine weitere im Plasma vorhandene Mn-Spezies darstellt, die möglicherweise

ins Gehirn aufgenommen wird. Darüber hinaus überstieg der Kin von Mn-Citrat den für die Diffusion in sechs Gehirnregionen, einschließlich des Nucleus caudatus, erwarteten Wert [93]. Der Nucleus caudatus ist Teil der Basalganglien, die bei Manganismus betroffen sind und in denen sich bei dieser Störung Mn ansammelt. Die Ergebnisse wiesen also auf eine zur Akkumulation von Mn beitragende, Carrier-vermittelte

Aufnahme von Mn-Citrat hin. Mit einer so hohen Aufnahmerate ist der Influx von Mn-Citrat ins Gehirn vergleichbar mit dem Influx des Mn2+-Ions, was nahelegt, dass Mn-Citrat eine check details der wichtigsten Spezies ist, die ins Gehirn gelangen [57]. Da die Speziationsergebnisse von Nischwitz et al. [57] von Körperflüssigkeiten nicht exponierter menschlicher Probanden stammten, untersuchten Diederich et al. [94] Mn-Spezies in Serum- und Gehirnproben von Ratten nach einer genau definierten Exposition. Sie befassten sich somit mit Frage (c). Diese Untersuchungen sollten das Verständnis des komplexen SGI-1776 cell line Metabolismus von Mn-Spezies in vivo verbessern. Die Ergebnisse belegten die Hypothese einer Bildung von LMM-Mn-Spezies in vivo. Die Aufnahme von anorganischem Mn, die mit einer einzelnen i.v. Injektion simuliert wurde, führte zu einer Überladung der ursprünglichen Carrier für HMM-Mn und zur Bildung von LMM-Mn-Spezies im Serum Mn-exponierter Ratten, wobei Mn-Citrat als Ko-Eluent der Hauptfraktion niedermolekularer Mn-Spezies beobachtet wurde. Dies stand im Einklang mit den Daten von Yokel und Crossgrove isometheptene [8], die zuvor bereits für Mn-Citrat und anorganisches

Mn höhere Influx-Koeffizienten aus dem Blut ins Gehirn gefunden hatten als für natives Mn-Transferrin. Die signifikant höhere Mn-Gesamtkonzentration im Gehirn und in der Niere Mn-exponierter Ratten ging auf die deutlich erhöhte Konzentration von Mn-Citrat und anorganischem Mn zurück. Daher schienen der unkontrollierte Transport und die letztendliche Akkumulation von LMM-Mn-Spezies im Gehirn und in der Niere der schädigende Pfad des Mn-Metabolismus nach Exposition zu sein. Die Muster der Mn-Spezies im Gehirn und in der Niere waren ähnlich. Die Autoren folgerten daraus, dass die Bestimmung spezifischer LMM-Mn-Spezies (Mn-Citrat) im Serum als Biomarker für eine subchronische Mn-Exposition in vivo von Nutzen sein könnte [94]. Im Hinblick auf die Fragen (d) bis (f) wurde eine Folgestudie durchgeführt, in der an individuellen gepaarten Proben mögliche Zusammenhänge zwischen Mn-Spezies im Serum oder Plasma einerseits und im Liquor andererseits untersucht wurden [95].

6 kb PmlI-SacII γ2b 3′ enhancer fragment described above, and amplified pBelo-CEN-URA vector with homology tail ends (using long oligos 385 and 560, and pBelo-CEN-URA as template). HC17 is an extension from HC13. The region including humanVH6-1-Ds-JHs followed by the rat μ, δ, γ2c and the modified γ2b region, was cut out from HC13 as a single ~ 160 kb NotI-AscI fragment. A cYAC/BAC construct was made from 4 fragments: the ~ 160 kb NotI-AscI region, a ~ 1.7 kb PCR fragment containing a 58 bp 5′ homology tail matching the sequence

~ 5 kb downstream of the γ2b membrane exon 2 followed by the sequence located ~ 3.6 kb upstream of the α switch region (using primers 591 and 592, and rat genomic DNA as template), the ~ 40 kb FspI-SalI region with Cα and the 3′RR from BAC clone CH230-162I08, and amplified pBelo-CEN-URA vector with homology tail ends (using long oligos 385 and 322, and pBelo-CEN-URA E7080 datasheet as template). The following oligos have been used: 252 [TGGAACCTGCTTAGGTCAGC]; Comprehensive details for all methods used have been described previously (Osborn et al., 2013). BAC Epacadostat in vivo inserts were purified after digests that released the vector DNA. For DNA microinjection BAC6-3, a 182 kb AsiSI-AscI fragment,

and BAC3, a 173 kb NotI fragment, were pooled with the particular C-region BAC on a NotI fragment (Fig. 1). Equal amounts of DNA were mixed in microinjection buffer and injected into fertilized oocytes at concentrations from 0.5 to 10 ng/μl (INSERM UMR 1064 and Taconic Biosciences, Cranbury, NJ). Three to five separately derived founder rats for each injected construct or line were bred to homozygosity with the JHKO heavy-chain knock-out strain (Menoret et al., 2010) at Charles River under specific pathogen-free conditions. All animal procedures involving care and use were in accordance with

the guidelines set forth in the Guide for the Care and Use of Laboratory Animals, available at http://grants.nih.gov/grants/olaw/Guide-for-the-Care-and-Use-of-Laboratory-Animals.pdf (the “Guidelines”), which are adapted from the requirements of the Animal Welfare Act or regulations concerning the ethics of science research in the INSERM UMR 1064 animal facility and approved by the selleck inhibitor regional ethics and veterinary commissions (N° F44011). Transgenic rats were identified by PCR from tail or ear clip DNA extracted using a Genomic DNA Mini Kit (Bioline). RNA was extracted from blood in RNAlater using the RiboPure blood kit (Ambion). cDNA was made using Oligo dT and Promega Reverse Transcriptase at 42 °C for 1 h. Detailed PCR conditions have been provided (Osborn et al., 2013). IgM was purified on anti-IgM affinity matrix (BAC B.V., Netherlands, CaptureSelect #2890.05) as described in the provided protocol. For rat IgG purification (Bruggemann et al.

In premature infants born before 35 weeks of gestation, ZDV should be administered at the above doses, but only 2 times a day until 2 weeks after birth and 3 times a day thereafter [7] and [15]. In Dasatinib in vitro addition, mitochondrial disorders of the newborn and future fatal lactic acidosis, as well as HELLP syndrome in pregnant women [16] should be taken into account. Other preventive measures are maintaining mothers’ blood HIV RNA level below the detection limit and maintaining immune function for as

long as possible. For this purpose, ART and preventive treatments for opportunistic malignancies and infections are performed [17]. ART is usually performed as a combination therapy of more than 3 drugs (HAART) [17]. The selection of anti-HIV drugs and the timing of the initiation of treatment are particularly important. ART for children is limited to only 3 types of drugs: nucleoside

reverse transcriptase inhibitors (NRTIs), non-nucleoside reverse transcriptase inhibitors (NNRTIs), Crizotinib purchase and protease inhibitors (PIs). The use of other new drugs for children is limited because of their restrictions for use and the dosage forms required. A combination of 1 PI and 2 NNRTIs can be administered to children. The NNRTI of first choice is efavirenz (EFV), because of its high efficacy and its availability as capsules. Nevirapine (NVP) syrup can also be used in children; however, it has side effects of severe rash and liver dysfunction. Protein kinase N1 After puberty, the treatment for HIV is the same as in adults. Points that require special attention in HIV treatment are multidrug interactions and side effects of individual drugs. HIV RNA levels and CD4+ cell counts must be measured regularly to estimate the efficacy of the drug and to detect drug resistance. In addition, side effects of and adherence to the treatment should be monitored. PIs and NNRTIs are metabolized by liver cytochrome P450 (CYP). Attention must be paid to their interaction with other drugs and herbs that

are also metabolized by CYP [18]. Immune reconstitution syndrome (opportunistic malignancies and opportunistic infections causing recurrence and re-exacerbation) might occur when ART is initiated after the onset of immunodeficiency [19]. It is caused by an induction of the suppressed immune response or inflammatory response. Anti-HIV drugs that are administered during pregnancy or to neonates have been associated with mitochondrial toxicity in neonates. Two deaths in Europe due to mitochondrial dysfunction in HIV-uninfected infants that were born to infected mothers who were treated with anti-HIV drugs during pregnancy were reported [20] and [21]. Therefore, we should be concerned about the subsequent onset of neuromuscular diseases among children who receive antiretroviral drugs, particularly during the neonatal period.

With this in mind, the European Commission has called for cross-border cooperation

in MSP [8] and [9] and has even proposed a directive to serve this aim [10]. This prompts questions of how advanced spatial planning coordination processes are within the supranational perspective of sea basins, what conditions should be fulfilled by countries to allow such systems to function, and which conditions are most difficult to fulfill, i.e., which present special challenges for the macro-regional, or sea basin level, coordination of maritime spatial plans. PLX3397 cost Resolving these problems is especially important in light of the European Commission׳s proposals in the draft directive on maritime spatial planning [10]. In an attempt to answer these questions, the present paper uses the experience of the Ku0059436 Baltic Sea Region (BSR) and Poland as a part of this macro-region. A three-step approach was used for the work: (1) the cornerstones of the Baltic Sea basin MSP coordination effort are identified and analyzed based on the literature and the author׳s own experience (informed insider view or participation approach); (2) the MSP in

Poland is analyzed with a focus on a critical examination of existing planning efforts and how these align with the cornerstones, because the Polish maritime administration announced the formal commencement of maritime spatial planning on November 18, 2013; (3) conclusions are drawn with the hope that they will trigger a general debate on MSP. Quite a number of papers describing MSP experiences in various countries and/or parts of Europe have been published recently [11], [12], [13], [14],

[15] and [16]. However, macro-regional experiences, including those of the Baltic Sea Region (BSR), are much less known even though the BSR is a pioneer of MSP cooperation on a sea-wide scale [6] and [7], and Poland was the first Baltic Sea country to develop a new legal framework for MSP in 2003. Thus, these experiences can be of interest to the wider public. MSP was initiated about 14 years ago in the Baltic Sea area with the BaltCoast ZD1839 supplier project, which was the first to formulate the concept of MSP and to propose basic MSP principles. The first political document that mentions MSP was the Declaration of Ministers responsible for spatial planning and development in the BSR countries of 2001 [17]. MSP in the BSR is linked inseparably with the cooperation of these ministers known as Vision and Strategies around the Baltic Sea (VASAB 2010). In 2001, the ministers also instructed spatial planners to “include off-shore and landside coastal areas” explaining that “growing spatial conflicts in coastal waters /…/ show a need to apply instruments of spatial planning” [17].

5. Displacements resulting from the zeroth order eddy-current phases (Fig. 5a and e) have spatially-uniform shifts of −0.78 mm for the unipolar sequence and 0.35 mm for Gamma-secretase inhibitor the bipolar sequence. The inclusion of first-order components resulted in comparable levels of displacement between the unipolar

and bipolar sequences, with maximum displacements of approximately 1 mm for both sequences. Including displacements from second-order phases (Fig. 5c and g) resulted in displacement levels that were substantially higher in the unipolar sequence (up to approximately 3 mm) compared to that of the bipolar sequence (up to approximately 1.5 mm). Displacement maps that included up to third-order phases (Fig. 5d and h) did not result in any discernible difference compared to those with up to second-order phases (Fig. 5c and g). Taking into account all diffusion directions (not shown in Fig. 5), the maximum displacements (relative to the b = 0 s/mm2 image) from third-order eddy-currents alone were less than 0.43 mm and 0.29 mm for the unipolar and bipolar sequence, respectively, for the axial Dasatinib purchase plane. Larger contributions were found in the 5z3 − 3z(x2 + y2 + z2) component compared to other third-order components (shown in Fig. 2g). However, third-order displacements of less than 0.96 mm (for the unipolar

scheme) and less than 0.31 mm (for the bipolar scheme) were seen in both sagittal and coronal planes. In Fig. 6a and b, displacement maps are displayed for the unipolar and bipolar sequences, over the six diffusion directions. The maximum displacements in mm (computed for the sum of all eddy-current orders and representing the difference between the maximum positive and negative Glutamate dehydrogenase image shifts over all diffusion-encoding directions) are displayed as contour/colour maps in Fig. 6c and d for the axial plane. Colour maps of the displacements

in three orthogonal planes are also shown. The maximum displacements were larger near the edges of the FOV, and showed deviations of up to 6 mm in the unipolar sequence, compared to 2.5 mm in the bipolar sequence. It is important to emphasize that the displacements in Fig. 5 and Fig. 6 are indicative and calculated using the approximation that the phases have accrued linearly. In the bipolar sequence, linear correction resulted in significant differences (p < 0.01, using paired t-test) in MD compared to the uncorrected case. Linear or higher-order correction resulted in no significant differences in the MD in the unipolar sequence. However, for both unipolar and bipolar sequences, there were significant differences in the FA when linear correction was applied (compared to the uncorrected case, p < 0.01 for both sequences), with a marked decrease in the mean FA value with linear correction. No significant differences were seen following higher-order correction (compared to linear correction, p > 0.01 for both sequences).

The endoscopic knowledge, equipment, and techniques have evolved in recent years, contributing to a paradigm shift in the diagnosis and endoscopic resection of CRC precursors. The nonpolypoid (flat or depressed) colorectal neoplasms (NP-CRNs) play a significant role in the genesis of interval CRCs.9 Such subtle-appearing lesions are indeed more likely missed or incompletely resected endoscopically than their polypoid counterparts, and a subgroup of them harbor an aggressive biologic behavior. This article provides insight into the magnitude and most common factors Galunisertib in vitro underlying the cause of interval CRCs during surveillance

for IBD. Milestones of the literature regarding CRC risk in patients with IBD are reviewed. Specifically examined to the occurrence of interval CRCs are the contribution of missed, incompletely resected lesions; the adherence to surveillance; and distinct biologic features of the inflamed mucosa. Key principles are presented for ensuring the quality of IBD surveillance practice. A casual glance at the overall incidence

of CRC in patients with IBD reveals discrepant outcomes, with a few studies showing similar CRC rates in patients with IBD versus the general population,10 and 11 whereas others show greater rates.12, 13 and 14 In a nationwide cohort of close to selleck chemical 50,000 Danish patients with IBD who were followed over three decades (1979–2008), CRC was identified in 338 (0.71%) cases (268 in patients with UC and 70 in patients with Crohn’s disease).10 The overall CRC risk among patients with UC in this study was similar to that of the general population (relative risk, 1.07; 95% confidence interval, much 0.95–1.21). In contrast, a North American study15 conducted from 1998 through 2010 found that the incidence of CRC in patients with Crohn’s disease or UC was 60% higher than in the general population. The Danish study found a marked decline in the

overall relative risk of CRC among patients with UC over the past decades, from 1.34 (95% confidence interval, 1.13–1.58) in 1979 to 1988 to 0.57 (95% confidence interval, 0.41–0.80) in 1999 to 2008,10 possibly reflecting refinements in the anti-inflammatory arsenal (ie, immunosuppressive therapy, biologicals), but perhaps also caused by a gradual adoption of CRC screening and surveillance. Conversely, the North American study15 found a fairly stable CRC rate in patients with IBD over time. Controversies surrounding the time-trends in CRC risk are not surprising, and likely reflect the cumulative effect of several factors, such as advancements in endoscope technology, a greater awareness, and improvements in the quality of colonoscopic performance. As a common denominator, such epidemiologic studies lack relevant information about the disease duration, degree and extent of inflammation, presence of risk factors (ie, primary sclerosing cholangitis, personal or family history of CRC), and patients’ compliance with the recommended follow-up.

Data suggestive of damage to mitochondrial metabolism have not been clearly confirmed. Storage lesions may be

more pronounced, since increased P-selectin expression and decreased agonist-induced aggregation was observed [67]. PI-treated platelets seemingly present a higher basic activation state, with higher surface expression of GPIIb/IIIa; this could explain the faster http://www.selleckchem.com/products/pifithrin-alpha.html clearance, leading to lower recirculation rates, observed in some clinical trials. The influence of the storage medium (i.e., plasma, InterSol, or Tyrode buffer) is obviously substantial and could explain some of the discordant study results. However, hemostatic function appears to be preserved in PI-treated PCs compared to standard PCs, under both static and flow conditions, in concordance with clinical observations that did not detect an increase in the bleeding risk. Some of the reactions following PC transfusion can be explained by the presence of cytokines and chemokines that are released during storage. The occurrence of undesirable reactions has notably been linked to the

presence of sCD40L. According to a study by Cognasse et al., treatment of PC with amotosalen/UVA does not increase the production of detrimental cytokines [68]. Published hemovigilance data predominantly concern INTERCEPT. This technique was approved in France in 2002 (AFSSAPS) and in Germany (PEI) and Switzerland (Swissmedic) in 2009. Switzerland EPZ015666 in vivo was the first country to implement INTERCEPT nationwide from 2011. Swiss hemovigilance data on the transfusion of 551 PCs revealed a transfusion reaction (TR) rate of 2% and a corrected count increment (CCI) of 10,000 after 1–4 h [69]. French hemovigilance data showed no increase in the number of platelet transfusions before and after

the introduction of INTERCEPT and confirmed the decrease in the TR rate [70]. A decrease in the TR rate linked to the use of additive solutions has been described Urocanase previously [71], but the French data appears to show a specific PI effect that is independent of plasma substitution. In Belgium, a retrospective study on transfusion data compared a 3-year period before and after the introduction of INTERCEPT; there were no differences in the number of PC transfusions per day of thrombocytopenia, in the total dose of platelets administered to patients, or in the number of red blood cell (RBC) transfusions given to thrombocytopenic patients [72]. Finally, a prospective hemovigilance program conducted in France, Belgium, and Spain that included 7437 PC transfusions, mostly in hemato-oncological patients, revealed an undesirable event rate of 0.9% after transfusion without any bacterial contamination [73]. These hemovigilance reports all confirm both the safety and efficacy of INTERCEPT-treated PCs in a huge number of platelet transfusions.

Finally, the government has eliminated an influential policy group, the National Round Table on the Environment and Economy established in the 1980s. It was reportedly closed down because it endorsed a carbon tax for Canadians and Canadian

business. Altogether, marine and environmental law, policy, science, and institutional capacity in Canada have been set back by decades. Given this situation, what are Canadian and international aquatic and marine scientists and other interested persons, such as coastal park managers, ocean managers, lawyers and policy specialists, to do? Some Canadians are simply retiring and/or leaving the country, but that does not help the future of Canadian marine waters, their living resources, and their ecosystems and biota! Several constructive actions seem viable: (1) Not all of the cutbacks have yet been enacted. The omnibus legislation has been passed but specific changes to regulations and other sections Belnacasan research buy within the affected laws still must be worked out and accepted. As well, some program cuts pertaining to people and specific research projects within the Public Service are passing through the system up to 2014. Hence, some changes and cuts could be reversed if protests were loud enough for the government to hear, and if government officials receive constructive critiques. Objections and opinions have

been voiced by some organizations, such as the American Association for the Advancement of Science, the journal Nature, the Royal Society of Canada, the Nova Scotian Institute of Science, and the Canadian Interleukin-3 receptor Parks and Wilderness Society. More commentary is needed from other www.selleckchem.com/HIF.html professional organizations and individuals,

especially from the international sphere. Canada’s environments and ocean spaces belong to humanity, so a broad international appeal is needed. Unless there are actions as above, it is another dark period for environmental and marine science and policy in Canada. Severe cuts have occurred over the past three decades to government operations, but somehow the affected departments rebuilt, albeit with smaller, focussed programs and very limited fiscal resources. Nothing of the current magnitude has happened before in Canada, inflicted upon the country by a government representing less than half (39.6%) of the voters. The question is – can we control or reverse the damage, or have these actions returned us to a pre – Earth Day (1970) or pre-Marine Pollution Bulletin period (1968)? Forty years of research capacity, enterprise and legislation are being reduced to a shadow of what is needed for adequate knowledge, protection and conservation of our aquatic ecosystems and species. An unnecessary crisis fuelled by political ideology, ignorance of the principles of sustainable development, and abandonment of the role of science in decision making is hurting Canada and diminishing our responsibilities for the blue planet.